The Infona portal uses cookies, i.e. strings of text saved by a browser on the user's device. The portal can access those files and use them to remember the user's data, such as their chosen settings (screen view, interface language, etc.), or their login data. By using the Infona portal the user accepts automatic saving and using this information for portal operation purposes. More information on the subject can be found in the Privacy Policy and Terms of Service. By closing this window the user confirms that they have read the information on cookie usage, and they accept the privacy policy and the way cookies are used by the portal. You can change the cookie settings in your browser.
The original version of this article contained an error in the shRNA sequence. The correct shRNA sequence should read as "TTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTT".
Non-small cell lung cancer (NSCLC) is the most common type of lung cancer and remains the leading cause of cancer-related death worldwide. Eukaryotic translation initiation factor 3, subunit d (eIF3d) has been recognized recently in several human cancers. In this paper, we attempt to evaluate the functional role of eIF3d in NSCLC cells. Lentivirus-mediated RNA interference (RNAi) was applied to silence...
Set the date range to filter the displayed results. You can set a starting date, ending date or both. You can enter the dates manually or choose them from the calendar.